Review



rabbit polyclonal anti-dync1h1  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Proteintech rabbit polyclonal anti-dync1h1
    Rabbit Polyclonal Anti Dync1h1, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/dync1h1+antibody/pm39793567-302-59-54
    Average 90 stars, based on 1 article reviews
    rabbit polyclonal anti-dync1h1 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: The Balbiani body is formed by microtubule-controlled molecular condensation of Buc in early oogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-GFP Molecular Probes Cat#A-11120; RRID: AB_221568 Rabbit anti GFP Molecular Probes Cat#A-21312; RRID:AB_221478 Rabbit anti-Buc Yenzym Antibodies LLC Hertig11 Rabbit anti-aTubulin Merck Cat#T5168; RRID: AB_477579 Mouse monoclonal anti-gTubulin Sigma-Aldrich Cat#T6557; RRID: AB_477584 Mouse monoclonal anti-mAB414 Abcam Cat#ab24609; RRID: AB_448181 Mouse anti-bactin Jackson Immunoresearch N/A Rabbit polyclonal anti-DYNC1H1 Proteintech Cat12345-1-AP; RRID: AB_2261765 Chemicals, peptides, and recombinant proteins Thioflavin (ThT) Sigma Aldrich Cat#T3516 Nocodazole Abcam Cat#ab120630 Colchicine Sigma Aldrich Cat#C9754 Taxol Abcam Cat#ab120143 Tricaine Sigma Aldrich Cat#A5040 Collagenase I Sigma Aldrich Cat#C0130 Collagenase II Sigma Aldrich Cat#C6885 Hyaluronidase Sigma Aldrich Cat#H4272 L-Arginine Sigma Aldrich Cat#5131 Ciliobrevin Sigma Aldrich Cat#250401 Deposited data Raw and analyzed data This Paper N/A Mass Spectrometry data (LC-MS Data) This Paper Tables S1 and S2 Experimental models: Organisms/strains Zebrafish: Tü wt This paper Zfin Zebrafish: Tg (buc:bucgfp-buc 3’utr) Bontems et al.92 Zfin Zebrafish: bucp43 Revenu et al.93 Zfin Zebrafish: Tg (bact:EMTB-3XGFP) Pauls et al.94 Zfin Zebrafish: Tg (vasa:GFP) Krovel and Olsen66 Zfin Zebrafish: Tg(h2a:H2A-GFP) Parichy et al.95 Zfin Oligonucleotides Primer: GFP Forward: GACGTAAACGGC CACAAGTTCAG; Reverse: GTTCACCTTGATGCCGTTCTTC This paper N/A KASP primer: bucp43 Genotyping SNP primer sequence: ATCCACTCTGTTGCCCCCACAAA ACTATTTGTCCTCAATTGGCAGTGCTTATTC CTACAGCTA[C/A]TACCCACAAGTGACCCAAG AGCGCCAGAGTGTCTTAAGTCCATCCATAGA TGAGCTCTCC.

    Mass Spectrometry:

    Article Title: The Balbiani body is formed by microtubule-controlled molecular condensation of Buc in early oogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-GFP Molecular Probes Cat#A-11120; RRID: AB_221568 Rabbit anti GFP Molecular Probes Cat#A-21312; RRID:AB_221478 Rabbit anti-Buc Yenzym Antibodies LLC Hertig11 Rabbit anti-aTubulin Merck Cat#T5168; RRID: AB_477579 Mouse monoclonal anti-gTubulin Sigma-Aldrich Cat#T6557; RRID: AB_477584 Mouse monoclonal anti-mAB414 Abcam Cat#ab24609; RRID: AB_448181 Mouse anti-bactin Jackson Immunoresearch N/A Rabbit polyclonal anti-DYNC1H1 Proteintech Cat12345-1-AP; RRID: AB_2261765 Chemicals, peptides, and recombinant proteins Thioflavin (ThT) Sigma Aldrich Cat#T3516 Nocodazole Abcam Cat#ab120630 Colchicine Sigma Aldrich Cat#C9754 Taxol Abcam Cat#ab120143 Tricaine Sigma Aldrich Cat#A5040 Collagenase I Sigma Aldrich Cat#C0130 Collagenase II Sigma Aldrich Cat#C6885 Hyaluronidase Sigma Aldrich Cat#H4272 L-Arginine Sigma Aldrich Cat#5131 Ciliobrevin Sigma Aldrich Cat#250401 Deposited data Raw and analyzed data This Paper N/A Mass Spectrometry data (LC-MS Data) This Paper Tables S1 and S2 Experimental models: Organisms/strains Zebrafish: Tü wt This paper Zfin Zebrafish: Tg (buc:bucgfp-buc 3’utr) Bontems et al.92 Zfin Zebrafish: bucp43 Revenu et al.93 Zfin Zebrafish: Tg (bact:EMTB-3XGFP) Pauls et al.94 Zfin Zebrafish: Tg (vasa:GFP) Krovel and Olsen66 Zfin Zebrafish: Tg(h2a:H2A-GFP) Parichy et al.95 Zfin Oligonucleotides Primer: GFP Forward: GACGTAAACGGC CACAAGTTCAG; Reverse: GTTCACCTTGATGCCGTTCTTC This paper N/A KASP primer: bucp43 Genotyping SNP primer sequence: ATCCACTCTGTTGCCCCCACAAA ACTATTTGTCCTCAATTGGCAGTGCTTATTC CTACAGCTA[C/A]TACCCACAAGTGACCCAAG AGCGCCAGAGTGTCTTAAGTCCATCCATAGA TGAGCTCTCC.

    Sequencing:

    Article Title: The Balbiani body is formed by microtubule-controlled molecular condensation of Buc in early oogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-GFP Molecular Probes Cat#A-11120; RRID: AB_221568 Rabbit anti GFP Molecular Probes Cat#A-21312; RRID:AB_221478 Rabbit anti-Buc Yenzym Antibodies LLC Hertig11 Rabbit anti-aTubulin Merck Cat#T5168; RRID: AB_477579 Mouse monoclonal anti-gTubulin Sigma-Aldrich Cat#T6557; RRID: AB_477584 Mouse monoclonal anti-mAB414 Abcam Cat#ab24609; RRID: AB_448181 Mouse anti-bactin Jackson Immunoresearch N/A Rabbit polyclonal anti-DYNC1H1 Proteintech Cat12345-1-AP; RRID: AB_2261765 Chemicals, peptides, and recombinant proteins Thioflavin (ThT) Sigma Aldrich Cat#T3516 Nocodazole Abcam Cat#ab120630 Colchicine Sigma Aldrich Cat#C9754 Taxol Abcam Cat#ab120143 Tricaine Sigma Aldrich Cat#A5040 Collagenase I Sigma Aldrich Cat#C0130 Collagenase II Sigma Aldrich Cat#C6885 Hyaluronidase Sigma Aldrich Cat#H4272 L-Arginine Sigma Aldrich Cat#5131 Ciliobrevin Sigma Aldrich Cat#250401 Deposited data Raw and analyzed data This Paper N/A Mass Spectrometry data (LC-MS Data) This Paper Tables S1 and S2 Experimental models: Organisms/strains Zebrafish: Tü wt This paper Zfin Zebrafish: Tg (buc:bucgfp-buc 3’utr) Bontems et al.92 Zfin Zebrafish: bucp43 Revenu et al.93 Zfin Zebrafish: Tg (bact:EMTB-3XGFP) Pauls et al.94 Zfin Zebrafish: Tg (vasa:GFP) Krovel and Olsen66 Zfin Zebrafish: Tg(h2a:H2A-GFP) Parichy et al.95 Zfin Oligonucleotides Primer: GFP Forward: GACGTAAACGGC CACAAGTTCAG; Reverse: GTTCACCTTGATGCCGTTCTTC This paper N/A KASP primer: bucp43 Genotyping SNP primer sequence: ATCCACTCTGTTGCCCCCACAAA ACTATTTGTCCTCAATTGGCAGTGCTTATTC CTACAGCTA[C/A]TACCCACAAGTGACCCAAG AGCGCCAGAGTGTCTTAAGTCCATCCATAGA TGAGCTCTCC.

    Solvent:

    Article Title: The Balbiani body is formed by microtubule-controlled molecular condensation of Buc in early oogenesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-GFP Molecular Probes Cat#A-11120; RRID: AB_221568 Rabbit anti GFP Molecular Probes Cat#A-21312; RRID:AB_221478 Rabbit anti-Buc Yenzym Antibodies LLC Hertig11 Rabbit anti-aTubulin Merck Cat#T5168; RRID: AB_477579 Mouse monoclonal anti-gTubulin Sigma-Aldrich Cat#T6557; RRID: AB_477584 Mouse monoclonal anti-mAB414 Abcam Cat#ab24609; RRID: AB_448181 Mouse anti-bactin Jackson Immunoresearch N/A Rabbit polyclonal anti-DYNC1H1 Proteintech Cat12345-1-AP; RRID: AB_2261765 Chemicals, peptides, and recombinant proteins Thioflavin (ThT) Sigma Aldrich Cat#T3516 Nocodazole Abcam Cat#ab120630 Colchicine Sigma Aldrich Cat#C9754 Taxol Abcam Cat#ab120143 Tricaine Sigma Aldrich Cat#A5040 Collagenase I Sigma Aldrich Cat#C0130 Collagenase II Sigma Aldrich Cat#C6885 Hyaluronidase Sigma Aldrich Cat#H4272 L-Arginine Sigma Aldrich Cat#5131 Ciliobrevin Sigma Aldrich Cat#250401 Deposited data Raw and analyzed data This Paper N/A Mass Spectrometry data (LC-MS Data) This Paper Tables S1 and S2 Experimental models: Organisms/strains Zebrafish: Tü wt This paper Zfin Zebrafish: Tg (buc:bucgfp-buc 3’utr) Bontems et al.92 Zfin Zebrafish: bucp43 Revenu et al.93 Zfin Zebrafish: Tg (bact:EMTB-3XGFP) Pauls et al.94 Zfin Zebrafish: Tg (vasa:GFP) Krovel and Olsen66 Zfin Zebrafish: Tg(h2a:H2A-GFP) Parichy et al.95 Zfin Oligonucleotides Primer: GFP Forward: GACGTAAACGGC CACAAGTTCAG; Reverse: GTTCACCTTGATGCCGTTCTTC This paper N/A KASP primer: bucp43 Genotyping SNP primer sequence: ATCCACTCTGTTGCCCCCACAAA ACTATTTGTCCTCAATTGGCAGTGCTTATTC CTACAGCTA[C/A]TACCCACAAGTGACCCAAG AGCGCCAGAGTGTCTTAAGTCCATCCATAGA TGAGCTCTCC.



    Similar Products

    antibody, anti-dync1h1 (rabbit polyclonal) pa5-49451  (Thermo Fisher)
    90
    Thermo Fisher antibody, anti-dync1h1 (rabbit polyclonal) pa5-49451

    Antibody, Anti Dync1h1 (Rabbit Polyclonal) Pa5 49451, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/silencer+select+sirna+to+dync1h1/pmc07906601-23-2-6
    Average 90 stars, based on 1 article reviews
    antibody, anti-dync1h1 (rabbit polyclonal) pa5-49451 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti-dync1h1  (Proteintech)
    90
    Proteintech rabbit polyclonal anti-dync1h1

    Rabbit Polyclonal Anti Dync1h1, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/dync1h1+antibody/pm39793567-302-59-54
    Average 90 stars, based on 1 article reviews
    rabbit polyclonal anti-dync1h1 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti dync1h1  (Proteintech)
    93
    Proteintech rabbit polyclonal anti dync1h1

    Rabbit Polyclonal Anti Dync1h1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/DYNC1H1+Antibody/pmc09568670-307-43-46
    Average 93 stars, based on 1 article reviews
    rabbit polyclonal anti dync1h1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti dync1h1  (Bethyl)
    93
    Bethyl rabbit polyclonal anti dync1h1

    Rabbit Polyclonal Anti Dync1h1, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/DYNC1H1+Antibody/pm35703091-190-166-178
    Average 93 stars, based on 1 article reviews
    rabbit polyclonal anti dync1h1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti dhc1 proteintech  (Proteintech)
    93
    Proteintech rabbit polyclonal anti dhc1 proteintech

    Rabbit Polyclonal Anti Dhc1 Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/DYNC1H1+Antibody/ppr0234427-164-68-71
    Average 93 stars, based on 1 article reviews
    rabbit polyclonal anti dhc1 proteintech - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    polyclonal rabbit anti dync1h1  (Rockland Immunochemicals)
    94
    Rockland Immunochemicals polyclonal rabbit anti dync1h1

    Polyclonal Rabbit Anti Dync1h1, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/IL-37+Antibody/10__1091_slash_mbc__e12___06___0458-170-34-63
    Average 94 stars, based on 1 article reviews
    polyclonal rabbit anti dync1h1 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    polyclonal rabbit anti-dync1h1  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology polyclonal rabbit anti-dync1h1

    Polyclonal Rabbit Anti Dync1h1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+polyclonal+anti-dync1h1/anti+dync1h1+primary+antibodies/10__1091_slash_mbc__e12___06___0458-170-34-38
    Average 90 stars, based on 1 article reviews
    polyclonal rabbit anti-dync1h1 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: Identification of host proteins differentially associated with HIV-1 RNA splice variants

    doi: 10.7554/eLife.62470

    Figure Lengend Snippet:

    Article Snippet: Antibody , Anti-DYNC1H1 (rabbit polyclonal) , ThermoFisher , PA5-49451; RRID: AB_2634905 , IF (1:200) WB (1:1000).

    Techniques: Stable Transfection, Expressing, Recombinant, Plasmid Preparation, Sequencing, Transfection, Construct, Knockdown, Reverse Transcription, Extraction, Transferring, Hybridization, Software